Recombinant E. coli LexA

Cat.No.
lexA-131E
Species
E. coli
Product Name
Recombinant E. coli LexA
Product Overview
The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD.
Description
E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence(TACTGTATATATATACAGTA). LexA"s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.
Form
50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol
Purity
Over 90% by SDS-PAGE (CBB staining)
Applications
1) Studies on the mechanism of E. coli SOS response.2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene.
Storage
Shipped at 4℃ or -20℃, and store at -80℃ for long period.
Concentration
0.8 mg/ml as measured by BCA method
Data Sheet
MSDS
logo 24/7

We are here to help you further your
development in the microbiology field.

SUBSCRIBE

Enter your email here to subscribe

Copyright © Creative BioMart. All Rights Reserved.